Bioinformatics
Institute of Computer Science
University Freiburg
de

LocARNA - Global and Local Alignment of RNAs

[Synopsis] [Webserver] [Download] [Publications] [News] [Misc] [Install] [Usage] [C++ API] [Contact]

Synopsis

LocARNA is a package of tools for producing fast and high-quality pairwise and multiple alignment of RNA sequences. It uses a complex RNA energy model for simultaneous folding and sequence/structure alignment of the RNAs. LocARNA performs global, sequence local, or even structurally local alignment of the molecules.

LocARNA-P is released as part of the LocARNA-package (probabilistic mode).

Contact: Sebastian Will.

Web Server

LocARNA and LocARNA-P are integrated in the Freiburg RNA Tools web server.

Download

Latest Release: LocARNA 1.8.1

Older releases (please don't use unless you have a very good reason; other releases are available on request): LocARNA 1.8.0

Main Publications

Please find further related publications in the publication list of the group.

News

Try the novel very-efficient RNA alignment tool SPARSE

SPARSE improves over the original locarna algorithm in terms of speed. Moreover, it implements and advanced lightweight simultaneous alignment and folding model, which improves its structure prediction capabilities. Currently, the tool offers a trade-off between alignment accuracy and speed. Thus, the choice of either algorithm should be based on the specific application requirements.

ExpaRNA-P predicts exact sequence and structure matches in RNAs of unknown structure

ExpaRNA-P enumerates exactly matching local sequence-structure patterns in RNAs of unknown structure, supporting full structural flexibility according to RNA secondary structure energy models (inheriting from the Vienna RNA package.) Based on ExpaRNA-P's exact matching, the tool ExpLoc-P performs very fast simultaneous alignment and folding of RNAs (think: "like LocARNA, but faster"). For highly efficient prediction, ExpaRNA-P introduces novel ensemble based sparsification techniques, which are a well used by SPARSE.

Check out the new realignment mode in REAPR

REAPR applies LocARNA for structure-based alignment of whole genomes to predict structural non-coding RNAs. With REAPR, we introduced a new realignment mode to LocARNA. In this mode, LocARNA aligns very fast within a small distance to a reference multiple alignment (mlocarna options --max-diff-aln and --max-diff).

Miscallaneous

LOCARNA-P: probabilistic mode

In probabilistic mode (mlocarna option --probabilistic), LocARNA computes more accurate multiple alignments based on a probabilistic consistency transformation and reliability profiles for assessing local alignment quality and localizing RNA motifs. These features are based on computing sequence and structure match probabilities due to the LocARNA alignment model.

RNAclust

RNAclust is a tool for clustering of RNAs, which builds on LocARNA. RNAclust is written and copyrighted by Kristin Reiche. It replaces the cluster pipeline that was used for our paper "Inferring non-coding RNA families and classes by means of genome-scale structure-based clustering".

The latest release is available at the RNAclust web site. It requires the LocARNA and the Vienna RNA package.

Short usage:

  RNAclust.pl --fasta your_sequences --dir output_directory

The full documentation of RNAclust.pl is available as PDF.

LocARNATE

An alternative way to construct multiple alignments using locarna. While mlocarna implements various types of progressive and iterative aligmnent, where sequence-structure alignment is performed in each single step, LocARNATE employs T-Coffee for combining pairwise locarna alignments into a multiple alignment.

LocARNATE is written and copyrighted by Wolfgang Otto.

Installation

LocARNA runs on recent GNU/Linux systems. Installation follows the usual scheme:

tar xzf locarna-xxx.tar.gz
cd locarna-xxx

./configure
make
make install

LocARNA requires the Vienna RNA Package (>=2.1.1).

If the Vienna package is not installed in a standard path, please add configure with option --with-vrna="path to VRNA installation" or after setting the environment variable PKG_CONFIG_PATH to the pkg-config directory containing RNAlib2.pc (prefered).

See ./configure --help for further options.

Some systems require adding the path to LocARNA's library to the environment variable LD_LIBRARY_PATH. If libLocARNA is not found by the tools, extend the search path by

export LD_LIBRARY_PATH=/usr/local/lib:$LD_LIBRARY_PATH

(in bash; assuming locarna is installed in the default path /usr/local/lib.)

Usage

There are two major uses of the tools, pairwise and multiple alignment and clustering of RNAs. The work horse of the tool package is the program locarna. However, we recommend the use of our high level scripts mlocarna, locarnate, and RNAclust.pl.

Multiple Alignment - using mlocarna

Assume an input file rnas.fa in fasta format, containing several RNA sequences.

For computing a multiple alignment of these RNAs call

mlocarna rnas.fa

In its default settings, mlocarna will produce a global multiple alignment of your RNAs. The program writes some output to the screen as well as output to a directory rnas.out, where the name is derived from the input name by default. The output directory can be controlled by the option --tgtdir. Help on the many options to mlocarna is available by mlocarna --help or more conveniently mlocarna --man. The distribution contains some example input in sub-directory Examples.

Anchor and Structure Constraints. The tool mlocarna provides a convenient interface for user-specified constraints on the alignment, including anchor constraints as well as structure constraints. Constraints are specified in the fasta file as follows:

>fruA
CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG
.......(((..(((xxxx))).)))...... #S
.........AAAAAA.BBBCCCC......... #1
.........123456.1231234......... #2
>fdhA
CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG
..............(((.....xxxxxx......)))........... #S
...........AAAAAA.....BBB.........CCCC.......... #1
...........123456.....123.........1234.......... #2

The structure constraints (lines #S) inherit their semantics from RNAfold. In consequence, the alignment can only be guided by base pairs matches that are compatible to the given constraints. The anchor constraints are specified by giving unique names to certain sequence positions, here A1,A2,A3,A4,A5,A6,B1,B2,B3,C1,C2,C3,C4 (lines #1,#2). Positions of the same name in different sequences are aligned. In each sequence, names have to be unique.

A second, slightly larger example of constraints is provided in Examples/haca.snoRNA.fa of the LocARNA package.

Multiple Alignment - using locarnate

Assume again an input file rnas.fa in fasta format, containing several RNA sequences.

For computing a local multiple alignment by locarnate call

locarnate rnas.fa

In its default settings, locarnate will produce a structure and sequence local multiple alignment of your RNAs. For most cases, we recommend to turn off both types of locality to get a global multiple aligment

locarnate --no-struc --no-seq rnas.fa

The program writes its output to a directory results in a subdirectory where the name is derived from the input name. The output directory can be controlled by the option --results. Help on the options to locarnate is available by locarnate --help. The distribution contains some example input in sub-directory Examples.

Clustering - using RNAclust.pl

Please jump to the RNAclust section.

Low Level Pairwise Alignment - using locarna

The pairwise alignment tool is called with two input files that specify the input sequences and optionally ensemble probabilities (as e.g.\ generated by RNAfold -p or). It accepts different file formats, which can be mixed freely. Available input formats are listed in order of increasing expressivity.

  • FASTA files or CLUSTALW files. This is the most convenient usage; LocARNA automatically predicts the ensembles of the sequences or alignments using the Vienna RNA library. LocARNA accepts an extended variant of the CLUSTALW format, which allows specifying anchor (line prefix #An) and structure constraints (line prefix #S and #FS).
  • Vienna dot plot files (dp_ps), which can be generated by RNAfold -p. This offers some flexibility in generating the ensemble probabilities (e.g., local folding).
  • LocARNA PP files in LocARNA PP format. This is the native input format of LocARNA, which provides most flexibility. The package provided tools to generate this format directly (locarna_rnafold_pp) or convert from Vienna dot plot format. It holds sequences or alignments together with ensemble probabilities; note that LocARNA can also output the generated alignment in this format. The same format is used by mlocarna for intermediate alignments. PP files can contain anchor constraints.

Further help

Further help is to mlocarna, locarnate and locarna is available via

  • help options
     mlocarna --help
     locarna --help
     locarnate --help
     
  • man pages
     man mlocarna
     man locarna
     

Library / C++ API

LocARNA implements an C++ API to its various algorithms and data structures. The library is installed together with the package, is used by the LocARNA programs themselves, and can be linked as shared library to other programs.

API HTML Documentation (release 1.8.1)

Contact

For raving comments, or in case of unexpected behavior or for questions and suggestions, please contact me (Sebastian Will). For special questions related to the RNAclust please contact Kristin Reiche.