LocARNA is a package of tools for producing fast and high-quality pairwise and multiple alignment of RNA sequences. It uses a complex RNA energy model for simultaneous folding and sequence/structure alignment of the RNAs. LocARNA performs global, sequence local, or even structurally local alignment of the molecules.
LocARNA-P is released as part of the LocARNA-package (probabilistic mode).
This software is associated to the project Local Sequence-Structure Alignment of the Bioinformatics Group Freiburg.
The package is developed by Sebastian Will. LocARNA is free software (GPL).
Immediately apply LocARNA online via our LocARNA webserver integrated with other Freiburg RNA tools.
REAPR applies LocARNA for structure-based alignment of whole genomes to predict structural non-coding RNAs. With REAPR, we introduced a new realignment mode to LocARNA. In this mode, LocARNA aligns very fast within a small distance to a reference multiple alignment (mlocarna options --max-diff-aln and --max-diff).
In probabilistic mode (mlocarna option --probabilistic), LocARNA computes more accurate multiple alignments based on a probabilistic consistency transformation and reliability profiles for assessing local alignment quality and localizing RNA motifs. These features are based on computing sequence and structure match probabilities due to the LocARNA alignment model.
RNAclust -- a tool for clustering of RNAs, which builds on LocARNA. RNAclust is written and copyrighted by Kristin Reiche.
An alternative way to construct multiple alignments using locarna. While mlocarna implements various types of progressive and iterative aligmnent, where sequence-structure alignment is performed in each single step, LocARNATE employs T-Coffee for combining pairwise locarna alignments into a multiple alignment.
LocARNATE is written and copyrighted by Wolfgang Otto.
LocARNA is distributed as source.
Latest Release: LocARNA 1.7.6
LocARNA runs on recent GNU/Linux systems. Installation follows the usual scheme:
tar xzf locarna-xxx.tar.gz
cd locarna-xxx
./configure
make
make install
LocARNA requires the Vienna RNA Package; a recent version is recommended.
For better performance, you may want to link to the Vienna RNA library (>= 2.1.1); for this purpose, add configure options
--with-vrna="path to VRNA installation" --enable-librna
See ./configure --help for further options.
Some systems require adding the path to LocARNA's library to the environment variable LD_LIBRARY_PATH. If libLocARNA is not found by the tools, extend the search path by
export LD_LIBRARY_PATH=/usr/local/lib:$LD_LIBRARY_PATH
(in bash; assuming locarna is installed in the default path /usr/local/lib.)
The latest RNAclust release can be downloaded from the RNAclust pages of Kristin Reiche. There you will find more detailed information about RNAclust.
Installation follows the usual scheme:
tar xzf RNAclust-xxx.tar.gz
cd RNAclust-xxx
./configure
make
make install
RNAclust requires the installation of the locarna package and the Vienna RNA package.
If you use our tool for your own scientific publication, please cite our article in "PLOS Computational Biology". When you are using LocARNATE or structure locality, please also cite the GCB paper.
There are two major uses of the tools, pairwise and multiple alignment and clustering of RNAs. The work horse of the tool package is the program locarna. However, we recommend the use of our high level scripts mlocarna, locarnate, and RNAclust.pl.
Assume an input file rnas.fa in fasta format, containing several RNA sequences.
For computing a multiple alignment of these RNAs call
mlocarna rnas.fa
In its default settings, mlocarna will produce a global multiple alignment of your RNAs. The program writes some output to the screen as well as output to a directory rnas.out, where the name is derived from the input name by default. The output directory can be controlled by the option --tgtdir. Help on the many options to mlocarna is available by mlocarna --help or more conveniently mlocarna --man. The distribution contains some example input in sub-directory Examples.
Anchor and Structure Constraints. The tool mlocarna provides a convenient interface for user-specified constraints on the alignment, including anchor constraints as well as structure constraints. Constraints are specified in the fasta file as follows:
>fruA CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG .......(((..(((xxxx))).)))...... #S .........AAAAAA.BBBCCCC......... #1 .........123456.1231234......... #2 >fdhA CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG ..............(((.....xxxxxx......)))........... #S ...........AAAAAA.....BBB.........CCCC.......... #1 ...........123456.....123.........1234.......... #2
The structure constraints (lines #S) inherit their semantics from RNAfold. In consequence, the alignment can only be guided by base pairs matches that are compatible to the given constraints. The anchor constraints are specified by giving unique names to certain sequence positions, here A1,A2,A3,A4,A5,A6,B1,B2,B3,C1,C2,C3,C4 (lines #1,#2). Positions of the same name in different sequences are aligned. In each sequence, names have to be unique.
A second, slightly larger example of constraints is provided in Examples/haca.snoRNA.fa of the LocARNA package.
Assume again an input file rnas.fa in fasta format, containing several RNA sequences.
For computing a local multiple alignment by locarnate call
locarnate rnas.fa
In its default settings, locarnate will produce a structure and sequence local multiple alignment of your RNAs. For most cases, we recommend to turn off both types of locality to get a global multiple aligment
locarnate --no-struc --no-seq rnas.fa
The program writes its output to a directory results in a subdirectory where the name is derived from the input name. The output directory can be controlled by the option --results. Help on the options to locarnate is available by locarnate --help. The distribution contains some example input in sub-directory Examples.
RNAclust.pl clusters a set of RNAs. It replaces the cluster pipeline that was used for our paper "Inferring non-coding RNA families and classes by means of genome-scale structure-based clustering". Note that for using this tool you need to install the locarna package and the RNAclust package. In the simplest case the script is invoked by
RNAclust.pl --fasta your_sequences --dir output_directory
The full documentation of RNAclust.pl is available as PDF.
Assume an input file rnas.fa in fasta format, containing two sequences seqA and seqB. That is, the file is of the structure
> seqA ... [Your first RNA sequence] ... > seqB ... [Your second RNA sequence] ...
On the command line perform the following steps
RNAfold -p < rnas.fas
locarna seqA_dp.ps seqB_dp.ps
Further help is to mlocarna, locarnate and locarna is available via
mlocarna --help locarna --help locarnate --help
man mlocarna man locarna
In case of unexpected behavior or for questions and suggestions, please contact me (Sebastian Will). For special questions related to the RNAclust please contact Kristin Reiche.