RN
LocARNA was developed in the project Local Sequence-Structure Alignment of our bioinformatics group.
LocARNA is main-developed by Sebastian Will, Copyright 2006-2008. You are free to use and modify the software for non-commercial purpose. The software and its modifications must not be (re-)distributed without reference to the author and this copyright notice. The LocARNA package comprises the single tools locarna, mlocarna and locarnate. locarnate is written and copyrighted by Wolfgang Otto.
Current Release: LocARNA 1.4.6
LocARNA runs on recent Linux systems. Installation on Linux/Unices follows the usual scheme:
tar xzf locarna-xxx.tar.gz
cd locarna-xxx
./configure
make
make install
A recent installation of the Vienna Package Vienna RNA package is required.
Installation on Linux/Unices follows the usual scheme:
tar xzf RNAclust-xxx.tar.gz
cd RNAclust-xxx
./configure
make
make install
RNAclust requires the installation of the locarna package and the Vienna RNA package.
If you use our tool for your own scientific publication, please cite our article in "PLOS Computational Biology". When you are using LocARNATE or structure locality, please also cite the GCB paper.
For computing a multiple alignment of these RNAs call
mlocarna rnas.faIn its default settings, mlocarna will produce a global multiple alignment of your RNAs. The program writes some output to the screen as well as output to a directory rnas.out, where the name is derived from the input name by default. The output directory can be controlled by the option --tgtdir. Help on the many options to mlocarna is available by mlocarna --help or more conveniently mlocarna --man. The distribution contains some example input in sub-directory Examples.
Anchor and Structure Constraints. The tool mlocarna provides a convenient interface for user-specified constraints on the alignment, including anchor constraints as well as structure constraints. Constraints are specified in the fasta file as follows:
>fruA CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG .......(((..(((xxxx))).)))...... #S .........AAAAAA.BBBCCCC......... #1 .........123456.1231234......... #2 >fdhA CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG ..............(((.....xxxxxx......)))........... #S ...........AAAAAA.....BBB.........CCCC.......... #1 ...........123456.....123.........1234.......... #2The structure constraints (lines #S) inherit their semantics from RNAfold. In consequence, the alignment can only be guided by base pairs matches that are compatible to the given constraints. The anchor constraints are specified by giving unique names to certain sequence positions, here A1,A2,A3,A4,A5,A6,B1,B2,B3,C1,C2,C3,C4 (lines #1,#2). Positions of the same name in different sequences are aligned. In each sequence, names have to be unique.
A second, slightly larger example of constraints is provided in Examples/haca.snoRNA.fa of the LocARNA package.
For computing a local multiple alignment by locarnate call
locarnate rnas.faIn its default settings, locarnate will produce a structure and sequence local multiple alignment of your RNAs. For most cases, we recommend to turn off both types of locality to get a global multiple aligment
locarnate --no-struc --no-seq rnas.faThe program writes its output to a directory results in a subdirectory where the name is derived from the input name. The output directory can be controlled by the option --results. Help on the options to locarnate is available by locarnate --help. The distribution contains some example input in sub-directory Examples.
RNAclust.pl --fasta your_sequences --dir output_directoryThe full documentation of RNAclust.pl is available as PDF.
> seqA ... [Your first RNA sequence] ... > seqB ... [Your second RNA sequence] ...On the command line perform the following steps
RNAfold -p < rnas.fas
locarna seqA_dp.ps seqB_dp.ps
mlocarna --help locarna --help locarnate --help
man mlocarna man locarna