RN Chair for Bioinformatics Freiburg - LocARNA - Local Alignment of RNA
University Freiburg
Chair for Bioinformatics
Institute of Computer Science

LocARNA - Local Alignment of RNA

Synopsis

LocARNA is a tool for producing fast and high-quality pairwise and multiple alignment of RNA sequences. It uses a complex RNA energy model for simultaneous folding and sequence/structure alignment of the RNAs. LocARNA performs global, sequence local, or even structurally local alignment of the molecules.

LocARNA was developed in the project Local Sequence-Structure Alignment of our bioinformatics group.

LocARNA is main-developed by Sebastian Will, Copyright 2006-2008. You are free to use and modify the software for non-commercial purpose. The software and its modifications must not be (re-)distributed without reference to the author and this copyright notice. The LocARNA package comprises the single tools locarna, mlocarna and locarnate. locarnate is written and copyrighted by Wolfgang Otto.

NEW Tool: RNAclust

RNAclust -- a tool for clustering of RNAs, which builds on LocARNA. RNAclust is written and copyrighted by Kristin Reiche.

Download and Installation of the LocARNA package

LocARNA is distributed as source.

Current Release: LocARNA 1.5a

LocARNA runs on recent Linux systems. Installation on Linux/Unices follows the usual scheme:

tar xzf locarna-xxx.tar.gz
cd locarna-xxx

./configure
make
make install

A recent installation of the Vienna Package Vienna RNA package is required.

Download and Installation of the cluster pipeline RNAclust

The latest RNAclust release can be downloaded from the RNAclust pages of Kristin Reiche. There you will find more detailed information about RNAclust.

Installation on Linux/Unices follows the usual scheme:

tar xzf RNAclust-xxx.tar.gz
cd RNAclust-xxx

./configure
make
make install

RNAclust requires the installation of the locarna package and the Vienna RNA package.

Main Publications

If you use our tool for your own scientific publication, please cite our article in "PLOS Computational Biology". When you are using LocARNATE or structure locality, please also cite the GCB paper.

Usage

There are two major uses of the tools, pairwise and multiple alignment and clustering of RNAs. The work horse of the tool package is the program locarna. However, we recommend the use of our high level scripts mlocarna, locarnate, and RNAclust.pl.

Multiple Alignment - using mlocarna

Assume an input file rnas.fa in fasta format, containing several RNA sequences.

For computing a multiple alignment of these RNAs call

mlocarna rnas.fa
In its default settings, mlocarna will produce a global multiple alignment of your RNAs. The program writes some output to the screen as well as output to a directory rnas.out, where the name is derived from the input name by default. The output directory can be controlled by the option --tgtdir. Help on the many options to mlocarna is available by mlocarna --help or more conveniently mlocarna --man. The distribution contains some example input in sub-directory Examples.

Anchor and Structure Constraints. The tool mlocarna provides a convenient interface for user-specified constraints on the alignment, including anchor constraints as well as structure constraints. Constraints are specified in the fasta file as follows:

>fruA
CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG
.......(((..(((xxxx))).)))...... #S
.........AAAAAA.BBBCCCC......... #1
.........123456.1231234......... #2
>fdhA
CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG
..............(((.....xxxxxx......)))........... #S
...........AAAAAA.....BBB.........CCCC.......... #1
...........123456.....123.........1234.......... #2
The structure constraints (lines #S) inherit their semantics from RNAfold. In consequence, the alignment can only be guided by base pairs matches that are compatible to the given constraints. The anchor constraints are specified by giving unique names to certain sequence positions, here A1,A2,A3,A4,A5,A6,B1,B2,B3,C1,C2,C3,C4 (lines #1,#2). Positions of the same name in different sequences are aligned. In each sequence, names have to be unique.

A second, slightly larger example of constraints is provided in Examples/haca.snoRNA.fa of the LocARNA package.

Multiple Alignment - using locarnate

Assume again an input file rnas.fa in fasta format, containing several RNA sequences.

For computing a local multiple alignment by locarnate call

locarnate rnas.fa
In its default settings, locarnate will produce a structure and sequence local multiple alignment of your RNAs. For most cases, we recommend to turn off both types of locality to get a global multiple aligment
locarnate --no-struc --no-seq rnas.fa
The program writes its output to a directory results in a subdirectory where the name is derived from the input name. The output directory can be controlled by the option --results. Help on the options to locarnate is available by locarnate --help. The distribution contains some example input in sub-directory Examples.

Clustering - using RNAclust.pl

RNAclust.pl clusters a set of RNAs. It replaces the cluster pipeline that was used for our paper "Inferring non-coding RNA families and classes by means of genome-scale structure-based clustering". Note that for using this tool you need to install the locarna package and the RNAclust package. In the simplest case the script is invoked by
  RNAclust.pl --fasta your_sequences --dir output_directory
The full documentation of RNAclust.pl is available as PDF.

Low Level Pairwise Alignment - using locarna

Assume an input file rnas.fa in fasta format, containing two sequences seqA and seqB. That is, the file is of the structure
> seqA
... [Your first RNA sequence] ...
> seqB
... [Your second RNA sequence] ...
On the command line perform the following steps

Further help

Further help is to mlocarna, locarnate and locarna is available via

Report of Bugs and Suggestions

In case of unexpected behavior or for questions and suggestions, please contact me (Sebastian Will). For special questions related to the RNAclust please contact Kristin Reiche.